BioloMICS menu

NLink - Import data in an NLink field

Movies BioloMICS: Import advanced including Fasta from 6.04 min.

There are two different ways to import for a link field:

Create a link to an existing record in the target table.
Create a new record in the target table and make the link.

Open the Import window. For instructions see Data import.
For scenario A (create a link to an existing record in the target table) we need to have the name (or id) of the mother table and the name (or id) from the target table.

Name

26s sequences

(Name field target table)

BIO 14

DQ279001 - Thanatephorus sp.

Note that in this example the Sequences table should have a record called DQ279001 - Thanatephorus sp.

When importing based on the name of the record, it is possible to import 2 links for 1 record.

Go to More options and select CSV file separator. Then use the separator that is selected in the import tool

The default separator is Semicolon (;).

Name

Name field target table

BIO 14

DQ279001 - Thanatephorus sp.;DQ279002 - Thanatephorus sp.

For scenario B (Create a new record in the target table and make the link) we need to have the same as scenario A plus the sequence for the N field (and other information if preferred).

Name	26s sequences (Name field target table)	Sequence (N field in target table)
BIO 14	DQ279002 - Thanatephorus sp.	aaaatccgtaggtgaacctgcggaaggatcattagtgaatataggacgtccaacttaacttggagtccgaactctcactttctaaccctgtgcacttgtttgggatagtaactc

Note that in this example the Sequences table should not have a record called DQ279002 - Thanatephorus sp.

For practicing purposes, copy the following to clipboard:

Name 26s sequences Sequence

BIO 14 DQ279002 - Thanatephorus sp. aaaatccgtaggtgaacctgcggaaggatcattagtgaatataggacgtccaacttaacttggagtccgaactctcactttctaaccctgtgcacttgtttgggatagtaactc

In BioloMICS in step 1 of the import wizard, click "Paste tabular data".
In step 2, check "Show target fields (max 1 level)" on the top-right to see all the fields of the target tables.
Link the fields to the corresponding field in the database.

The Name field target table (26s sequences) should be connected to the Record name of the target table (Sequences).

The Sequence should be connected to the N field in the target table (Sequences).
In step 3, append or merge the data. For more information about merging data in an NLink field, click here.